CBrugiaQ_4198


Sequence

>CBrugiaQ_4198 (2 EST) Length=172 AGAGACAAAGAAGAATCAGATGATGACATCGGGTTTTGGTCTTTCGACTAAAATTCGCCATAGTGTTACTATTTGATCAA AAATTTGTTATTTCTCTGCTTTTGGCTTTGGTAAAAAAATAAAAAAAAGAAAAATAAAAAAAAAATAATAAAAAAAATAC CGGAGACTGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_4198: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7619991681867AA123556MBAFCE7G08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9101261906191AA269129KJ4SLB295T3JHU93SL-BmL4 (JHU)


Date: 4:48:37 on Sat 25 Nov 117.