CBrugiaQ_4199


Sequence

>CBrugiaQ_4199 (4 EST) Length=158 ATTAGATTTATCTTAGATTATTAAACTATCCTAGAAGTGGCGCAAAAGTTTCATCAAAAGAAGCGCCATTGTGAAATGCT TATTATACAGTTTCTGTGCATTAATTATTTTCCGTGGAAAAATTGAAAGTTCGAATTGTGAATAAAATTCATTAAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_4199: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7473111660921AA109281MBAFCE2C02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003371737720AA161541MBAFCG0G09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003381737721AA161542MBAFCG0G10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10481232064770AA406713MBAFCZ4E09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 11:20:11 on Sun 19 Nov 117.