CBrugiaQ_422


Sequence

>CBrugiaQ_422 (5 EST) Length=618 TTTCCAAAAAAAGAAATTTTTATTTAACAAACTATTCAGGCATAATATAAATTAGGCTAATACCAATGCACTGTCAAATG GACAGCAGTAAAAGGACAATAACATTATTCGTTTCAAAATTAAAACTCCTCGGAAAAAAAAGCTGGTCAAGATAAACTAT TTTTAGGCTTTTCGGACTATTACTGGCTTGACAGTTCGAAGATGTGACTGCATTTCCTCTTCCGCTGCTTGCTTCTTCCG TCGCATTTCCGTGTATTTTTGAATTTCATTTTCCAATTCTTTATTCAAATCATCAACTGTTTTCCCCTCGAACATCACGG CCACAGCACTTTCAATAGAAGGAGTTTCCATTTGCTTCACTGGTAACTCGTTCACCACTTCTTTATTTTCTAAGTGATAC TTACTAGCTAAACGGTGCAACTGATCTTCCAATGACCGATGTGTCTCAGGTGTGGCATCCACAAGTCCACCTTCTTTTCC AGCCATCTTGGACTCATATTCCTTGATCTTTTTCAGAAATAAATTCTTAACTAAGTTATCCGATTTGAAACTTTGCGTTC CTGTGCTTACCATTCGCCATCCTGCTGGTAATCTCAATCGCAACAACATCATCAAGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_422: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217771808593R47706AS3ISB071SLBrugia malayi infective L3 JHU93SL-BmL3
7062051592623AA072498SW3ICA1648SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8678981850663AA228556KJ4SLB420T3JHU93SL-BmL4 (JHU)
8986921893297AA257807MBL2SJ3D11T3Brugia malayi second stage larvae JHU96SL-BmL2
9140791912003AA273068SWMFCA1873SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:30:49 on Thu 23 Nov 117.