CBrugiaQ_423


Sequence

>CBrugiaQ_423 (3 EST) Length=619 ACCAGGTCCAAAAACCAGGATGGCAGGGGGAGAGCTTACCCTTCAAAGAGGGCAACAGGGGGGGGACCCCGTTATCCGGG ATTCCATTCAACAATGCCCAAGTGGTAAGGACCCAGGAGGCAAAACAGGGGACAAGCAACAAGCCTGGATGGCTAAAGTA ACATGGTGGGGGTGTTGGAAGGTTTTCAAAACAGGATTCTGGGTNNATCTTTTCACGGTTGCCCTTGNGGGTTCAGGGAG CCTCGGTGAGCAGCACGGGTGNTCNTCGGGGCCACACGCAGCTCGTTGTAGAAGGTGTGGTGCCAGATCTTCTCCATATC ATCCCAGTTGGTGACGATGCCGTGTTCAATGGGGTACTTCAGGGTCAGGATGCCTCTCTTGCTCTGGGCCTCATCGCCCA CGTAGGAGTCCTTCTGACCCATACCCACCATCACGCCCTGGTGCCTAGGGCGGCCCACGATGGAGGGGAAGACGGCCCGG GGAGCATCGTCGCCCGCGAAGCCGGCTTTGCACATGCCGGAGCCGTTGTCGACAACGAGCGCAGCGATATCATCATCCAT GGCGAACTAGTGGCGGGTGTGGAGCGGCGGCGGAGGAGCTTGCGACAAGTCTCTCGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_423: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6807001547263AA054929SWMFCA803SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8675601849790AA228219SWMFCA1258SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11919512307193AA545902SWMFCA2459SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:24:51 on Mon 20 Nov 117.