CBrugiaQ_4230


Sequence

>CBrugiaQ_4230 (6 EST) Length=152 CGCGGGGGCGGCCGCACTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGAAAAAAAGAAAAAAAAAACAA AACAAAAAACCGCCATCAAAAGGTAAAACATTACTAACAATAACAAAACGGCGCATTATGAACTAACAGCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_4230: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7620241681892AA123581MBAFCE8B05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620271681895AA123584MBAFCE8B10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003401737723AA161544MBAFCG0G12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196441763825AA180633MBAFCG1D02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8984051893010AA257280MBAFCZ1A12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8984871893092AA257421MBAFCZ2A4T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 10:30:35 on Mon 20 Nov 117.