CBrugiaQ_4247


Sequence

>CBrugiaQ_4247 (2 EST) Length=171 TTACGAGATNTATATCTTCTANATAGTCNAGNTCNACCCTCTTTTCTGCGCTCCNGAGAGAGAGAGAGAGAGAGAGAGAG AGAGAGAGAGAGAGAGAGAGAGAGGGATACAGAGAGTGAGAGATATGTATACTTTACATAAGATGAATGCTCATGCCACA TTCGGCACGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_4247: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722431537190AA052012SWMFCA716SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7471911660801AA109265MBAFCE0F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 8:57:12 on Tue 21 Nov 117.