CBrugiaQ_4281


Sequence

>CBrugiaQ_4281 (2 EST) Length=140 TCTCCTCCTTCTACTCCCTCTCTCTCTCTCCCTCCCTCTCTACCTGCTATCCTGTAATTTTTCCATACAATCAACAATTC TACCGGACGAATATCACATTTTTCTCTTTCTCTTCCAACTCTACGAAATGTATTGAACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_4281: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4448241167721N43323SW3ICA921SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4458531182870N44351SW3ICA1187SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 14:23:44 on Mon 20 Nov 117.