CBrugiaQ_4296


Sequence

>CBrugiaQ_4296 (2 EST) Length=141 AAAACACGGAAAGGAAGAAACAGTTTAAAACTGAAAATAGCTCACTTTCCTTTTTTTTTTCATGTCATTATTATTGGTTA ACACTCCTTGGAGTGTATTTTATTGTTTTATAAATATCAAAATAAATTTTCTGTTAACACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_4296: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8808201870804AA241486MBL2SJ0A7T3Brugia malayi second stage larvae JHU96SL-BmL2
11888152289679AA542767MBL2SK3C02T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 12:56:15 on Sun 19 Nov 117.