CBrugiaQ_430


Sequence

>CBrugiaQ_430 (2 EST) Length=763 GATCAATTGAATAAATCATTGGTGTTAAATCAGTGCCAANAAACAAACCATTGATAATATTAGAAGTAGTAAAATCATCA TTTCGTTGTCGCATATATAAAAACAGAACCATAATTATGGATATTAAATTTAACAATGATAAAGTTTGAGTCCAATTTAT ATAAATGATTGAAGCTTTATAAAAGCCTAGCGATGAGCCAAAGATGAATAATAGCACAATTAGAAGACATGAATGAAACG AATTTACCGGATGACATTCTCGTTCTCCCATGCTATTGACAACTGTAACAAAATCTTTGGGTAAAACAAGATGAAAGATA AGTTGTAAAAGAGTAATAAAAACAAGAATTTTCCAAGGCACCGATGAAAATGGTGATGGAAAAATTTGATAAAGTACACC ATTTTCTGACCATAACATTTGAAGAAACTGAAGAAATGATGCATCACAATTAGTTATCGCATAAATGTGCAAATAAAGAA GAAATGGTCCACCACAAAGTATCGATATTAATAATTGTGGTGAAAAATTTCGTTTTTTCTGTGCTTCAGCAATTTGAATT CGTTCACCATCCTTTAAATTACACGATGATCGCCTGGATGGTATGGAATGTTGTGAGCCAACAAGTGATGAACGCCGATT ATTGCGAAGCATTATTGCTTATTGTTGTCGCTGTTGTTATTGTTATTGTTGTTGTTGTTGTTAGTGCTACTGTTGTCGTC GTAATCGTAATCGTAGTCGTAGTTTTTGTTGCTCAAACTTGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_430: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7524041668388AA114492MBAFCE6A12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10614392078589AA417418RRAMCA1403SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:33:7 on Sun 19 Nov 117.