CBrugiaQ_4315


Sequence

>CBrugiaQ_4315 (3 EST) Length=125 CTTTTTTTCCCGGCCTCCGTATTATCTTTCAAATTGTCGTGCTGTTAAGCGGAACAATCAGTTTGGACGTAGCTCAGGAC GTAGCCCTGATAATATTGCTACGCCTCGAGAATAAAACCAATTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_4315: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281859890043H21348AS3ISB362SLBrugia malayi infective L3 JHU93SL-BmL3
8712851854357AA231943AS3ISB101T3Brugia malayi infective L3 JHU93SL-BmL3
8981991892804AA257302MB4SLM1D7T3Brugia malayi L4 JHU93SL-BmL4


Date: 1:53:25 on Sat 18 Nov 117.