CBrugiaQ_4338


Sequence

>CBrugiaQ_4338 (2 EST) Length=143 AAGTAATATGATTTTAATGTGCTTATTGAAAAGTGGAAATTACATAAAATACACTCACATTGTACATTCGAAGCAAATTT TAAGGGAACTTTGTATTGTAAAATCGTGCCGAATTCGGCACAAGATACAGTTTCCTGTTGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_4338: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5220971289169W15132RRAMCA1258SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8497291809180AA210651SWMFCA443SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 8:30:54 on Fri 24 Nov 117.