CBrugiaQ_436


Sequence

>CBrugiaQ_436 (4 EST) Length=617 ATTGTATTAGGTAAAATATCACGTACTTCACGAATTGGATCAGAAATCATACGAGATGAATTACCGATACGTAACGCATT AAATGAAAGACGTCGCATTCTATTATTTCGGAATAAATTATCAATATGTATTGCATTAATAGAAATACGACGAATTAAAT TATTAGCACATATTGTATGAATTGAATTACGCATTATACGAAACAAATTATCGATACGTATCGTATTGACTGAAACATTA CGTATTCCGTGAATTAAATTACCACCACGTATTCCACGAATTGAATTACGCATCATACGAAATAAATTATTAATACGTAC TGTATTAATTGAAGTACCACGTAGTGTACGAAATAAACTATTAGCACGTAATGCATGAAATGAATCACTGACGATAATAC TTATTATATAAAGTGAATTATCAATAGATATCATATAAACGGGACTTTCAGCATTTATCATCTGAACTAAATTATCATTA AGCATTGGATGAGCCGAATTTTCGGCACATATCAAAATGATATTTACGGCAGAGATTGAGTTATTAGTACCTATCACATG AACTAAATTATCTAATTGTTCACGTGGTACTAATGCTCGTGCCGAATTCGTCACGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_436: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7524011668385AA114489MBAFCE6A08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7566331673258AA118209MBAFCE6E03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8985231893128AA257626MBAFCZ2E1T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247382539381AA626994MBAFCW2C07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 18:57:11 on Thu 23 Nov 117.