CBrugiaQ_438


Sequence

>CBrugiaQ_438 (2 EST) Length=597 CTCGTGCCGCACCGCGAGAATATGAAGTACGAATAAAGGTTTTGTATACTGCGATATGTCATACGGATGCTTACACATTG GATGGTGATGATCCGGAAGGAGTATTCCCCTGTATTCTTGGACATGAAGGTGCTGGCATAGTGGAAAGTGTTGGTAGTGG CGTGACATGTGTGAAACCTGGGGATCATGTTATTCCATTATACACAGCACAATGCAAGGAGTGTAAATTTTGTCTTAATC CGAAAACAAATTTGTGTCAACGTATTCGGGTAACACAGGGACAGGGTTTGATGCCAGATAAGACGACTCGTTTTTCGCAA CATGGAAATGCAATATATCACTTTATGGGTTGCAGTACTTTTAGTGAATATATTGTCGTGTCACAGTATTCTGTTGCAAA GGTACCTTGTAATGCACCATTGGACAAGCTTTGTTTGCTTGGCTGTGGTGTTTCAACTGGTTATGGAACAATGGGTAAAC AATTGCAAAGTTGAACCGGGCTCTACTGTTGCAGTTGTGGGGGCTTGGTACCGTTGGGTTAACCGTCATTATGGGAACTC GAATTGCTTGGTTCCAGGTTGATCGTGGGAATTGATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_438: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8679231850688AA228588SWMFCA1283SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11253722209440AA480742SWMFCA2111SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:44:14 on Wed 22 Nov 117.