CBrugiaQ_4387


Sequence

>CBrugiaQ_4387 (3 EST) Length=111 ACAGTTTAAGAATTTGGTCCAGGATGACGAATGAAGTTGGACCGAGTGTGGATGGAGTTGAAAGTGAAAAGAAATTGTCG AAGAAAGAACTGAACAAATTGGCAAAGCAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_4387: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8809351870919AA241627MBL2SJ2D5T3Brugia malayi second stage larvae JHU96SL-BmL2
8810061870990AA241581MBL2SJ8D6T3Brugia malayi second stage larvae JHU96SL-BmL2
11888482289712AA542800MBL2SK3H04T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 12:2:50 on Thu 23 Nov 117.