CBrugiaQ_4420


Sequence

>CBrugiaQ_4420 (2 EST) Length=101 AAAAAATTTCTACCGTAACATCAAAGGGTTAGGACTTAACGAAGCAATTTTGGGTGATCCTTTCTTTTGTTTCGTTATAT ATTTGTGGATGAGGCGGATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_4420: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8985361893141AA257664MBAFCZ2F5T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480172064664AA406672MBAFCZ2F05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 6:43:16 on Sat 25 Nov 117.