CBrugiaQ_4426


Sequence

>CBrugiaQ_4426 (3 EST) Length=97 CTCGTTTTCTTCCCTTCTTCTTTTCAGTCTTCCGATGTTTTAACACTTCCATTGGTTGTTGTGTCACTTTACGAGCTACT TTTCTAGGTGGCATTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_4426: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8808531870837AA241519MBL2SJ0D6T3Brugia malayi second stage larvae JHU96SL-BmL2
8988011893406AA257631MBL2SJ4H3T3Brugia malayi second stage larvae JHU96SL-BmL2
11888092289673AA542761MBL2SK3A12T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 2:46:14 on Fri 24 Nov 117.