CBrugiaQ_4456


Sequence

>CBrugiaQ_4456 (2 EST) Length=70 CTTTTATTTCAGAAGCTCTTGATCTCTAGGTACGAGGGATGTTATATGATTGTGTGTGGGAAAGAAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_4456: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281197889954H21259AS3ISB162SLBrugia malayi infective L3 JHU93SL-BmL3
281214889971H21276AS3ISB161SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 10:49:17 on Tue 21 Nov 117.