CBrugiaQ_4482


Sequence

>CBrugiaQ_4482 (2 EST) Length=66 ATCAAATCTCTTAAATTACCAATTCATGTCATTATAATGTTGTGTGTTAATAAATGATAATCAGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_4482: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9141121912482AA273108SWMFCA1937SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12212922345189AA570896SWMFCA2669SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 21:55:8 on Sat 18 Nov 117.