CBrugiaQ_4498


Sequence

>CBrugiaQ_4498 (3 EST) Length=55 GCTAGAAGAAATCATCAAACAAGCAGAAGAAAAGTGATCAGTTCAAGAAACAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_4498: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8712891854361AA231947AS3ISB010T3Brugia malayi infective L3 JHU93SL-BmL3
8987821893387AA257871MBL2SJ4E12T3Brugia malayi second stage larvae JHU96SL-BmL2
9165231917143AA275495MBL2SK1D12T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 10:30:50 on Mon 20 Nov 117.