CBrugiaQ_45


Sequence

>CBrugiaQ_45 (4 EST) Length=883 GAATCTCCCTGTATCAGCCGTCGCGGGTTATTTCAGGATGTTTCGACCCATCTTTGAAACCCATGGGATTAAAGCGGAGT TTTGCAAAAACCCTGGAAACCCATTGGTGGCTTCTTCCAATTATAAGAAGCATTTCTCAGCCAAGTCCACGTTTAGGGTA ATCTTTATGCACGAAATAACAGACCACAGCAGCAAACGTTTTAATTTTGGATCAATGAGAATCCCAAATCTGGCTTTCCA GTTCCTCAAGAATATCCAGGATAATCTGACCCTTGGGACTCATTGTTTTCGTTGCTGTCTTCTTATTACAACCACTGGTG GAAATTTTAATTCCCAGAGGACCTTTNNNANGTTCATTGTGTTGCTCGTCCTCTGGTCGATTCAATATTGAAGCCAACCT AAGTGCAGCGATCTCTCCATCCGGTTTTCGTAGCATAAACGATAACGATGAGGCAATCCCACTGTTTACCAAATCATTAA ACAGTTCATCTGAATCTTCGGCATTTAGACTGACTGATCTGTTCAGCGGTTCATTGTATAAGAAATCGGTTAACAGAAAT TTTTTAACACAATCAAAATCGCTTTCGGTAATTCGATGCATGGATAATCCATTAAAATTCGTCTCCGCCATATGTGAAAT ACGAACATAGTAGATCCTCGAATTTCGTTCATAAATAAAGTGAGCACTTGAAAACTGTCAACTGTTGCGCTATCGAACCA CTGATCCAGTAACCATATCGATCTACTCCTATTTATTGGATCAATGAGAAGATAATGCCTCCTACTGAACACTGAATTTT TGCCTTCTATTTGATTAAGACTAATTCCTAGTCATAATCATAGTTAAATCATCCACCCCTTGAGCTTCACAACATCGAAA AGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_45: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5441671318061W36315RRAMCA1244SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5596691349175W51714SWAMCA729SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8981511892756AA257228SWMFCA1532SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12139512335033AA563568SWMFCA2554SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 16:16:44 on Sat 18 Nov 117.