CBrugiaQ_451


Sequence

>CBrugiaQ_451 (4 EST) Length=588 CATATATACAACATATAAACGATTAAGCCTGGAAAATCTAAAAATCTCGATCAGAATGCCCTTAATTCACAAATGTGGAC TGAAATGAAAGTTGCCACACGTATTCACATGACGATATAACATACGATCCCACCATAACAATTCACCATCCAGGCACATG TCACGGCCACGATCCTCAAACTGGAACATTATTCTGATCAGAATATAGAATACGACGACAAACGAGCCAGCATAAAGGAA CACAGACCGTGGAGTGTAACGGAAAAATTCGTATTGCATCGCATTGGCCGAATACCAACGAAAAACAGCTGGGTCAATTA TTACACCTTCTCTATACTTGAAGGTATGTGGGTCGTATTCTCGTCTAAGATACTCTTTCTTCAAAATTTCTTTTAATCGA TATCGCCATAAGACAGCCTTTTTTTCTTCATCGCTAATGCCATAATCTTCTCCAGCGATGAACTTCATTTTTCCATGAGT TTCAAAATATCCCAGTACTGGATCTTGCCAAAGTTTTGTATTTGTTGGCATTTTGCGCCTTACCAGCGAGAATAACATTC CTATTTTTCATACACCTTTCACCTCAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_451: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4458671182884N44365SW3ICA1203SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7523371668321AA114477MBAFCE5A01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9141221912492AA273118SWMFCA1970SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11538822247096AA509219MBAFCX8G02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:30:14 on Fri 17 Nov 117.