CBrugiaQ_455


Sequence

>CBrugiaQ_455 (8 EST) Length=1071 GGAGGGGAATTCAACTAAGTCGAGTACGGTTTATTATGGACATATTCGGGAACCAATGATGCATCTTCAATTAACACATT CTTTAGTTTCCATAGATTCTGGAGATTCTTCCAACTCATTGTTCTCTATTCTAATTTCTTCATGGACGGCTTTCACTATG AGTTGCTGGTAAGAGATGAAGCTCATCAGTTTCTTGTTCATTTACAGTGGTCTCGTGTAAATGTTTCTGTTCCAATTCAT CACCTCCTTTCCATACATTATGTAAATCGCTTTTCAAGTTCTCTTCTTTTGCACTAACAGTCCAATTATCATCGAGTTCA ACACCTTCAGCCGCAGCCTCCAATTCTTCGACTGGTACGGGCTCATAGCCTTCAGGTATTTCTTCACTCTCAAATACAAC ATATTGACCATCGGTATCTTCGCCATATGTATATAATACAGGACCATTCACTTCATCCGGATGACGTTGTCCACGACGAA GTGAACCGTCTGCTGACAAACTTTTCGCACGATCGATTCTACCCAAACGATTTTGTCGAAAGTATGATTTACGTACGCGA CTCGTGCCGCTCGTGCCGATTCGGCACGAGTTTGAGACAATGTTTGGAGGACCTCCATTTCTACGTTATCCGTTATGGCG TTTCACCGCTTTTTCGGTGGTTGCCTCAACTGCGGTGTCGGGAATTATTTTTATGATGTTACGTAGAAATGAAAACATGC GACGAAAAAAATGGGAAGAGTTTTTCAAAAATTACGATGCGTATGAACATATAAAAGAAATTTGCTCACATGCACCAGGA ATAATGCATAGCTGTCCCAAAGACCTCGCTTTAGCATATGAAAAAGCTGGATTGAAAAGTAGATGATAAATGCTCGTTAA ATCGATTTTTTGTAGTGATCTTGTTTAGTGTTTTAGTGAACACTAATGAAATGTATCTTCTTAGATTCTTGAAGTCAATA ACTATACTGATTCGTTTTTGTAACTTCTTAAATCCGCGAAAGTCGATAATTTTACCGACTCCTTTTTGTAATTTAAATTG CTTTATCAGAAGTATTATAAATCTGGCTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_455: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217671808493R47606AS3ISA024SLBrugia malayi infective L3 JHU93SL-BmL3
273948878854H14034AS3ISB370SLBrugia malayi infective L3 JHU93SL-BmL3
7619691681837AA123513MBAFCE7D07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8249191769748AA185860SW3ICA1964SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9100201906085AA269017SWMFCA1811SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9215141923365AA280504SWMFCA2203SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11539462247160AA509283MBAFCX9E03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11887862289650AA542738MB4SLY2G03T3Brugia malayi L4 JHU93SL-BmL4


Date: 2:33:28 on Fri 24 Nov 117.