CBrugiaQ_463


Sequence

>CBrugiaQ_463 (16 EST) Length=582 GGGATAACCGANCCNCCTTCTTGGCAAATTGATACCNATTCCCACTTCATCCCCCATTGTAGGGTAATTTGATACNTTAT TGTTTTTTTCACCCGAAACCCAATTATTTGATTTGCTGAACAAGTTCATTTCTTTGTCCNAAAACTAAATTTAATNCAAT GTGTCGCTGTAATAGAAACTGAGCACTCTTTGGAAACTCTCTTTTACACTGAGTCCCTCTCGTACGTAAAGACGATTTGC TACACTTAACGTGTAATTTCTACTTTCTGCCTCTGCGATATAAGCCAATTGTTTGATAAAATGAAGTCGGAATTCTGGTA TGCTAGCATCTTTTCCAAGGGCACTCTGCAGTTGCTGCTTCGTTTCACCGTCCGCTGCAAGGTAAGCAATAAAAAGTGAA GTTGAAACCGAAAAAGGTGACAGAACGGATGATTTATCGCTTTCCGCAACATTTTGCAGTAAACTTACCGCAAAGTCTAA CTGCGCACGTTCCGTTAACGAAATTTGTCCAAGTATTGAGATGAATTGAGCACTTGCAACTAGAACAAATATGGCGGTAA TTGTTTGATTTTTCATTCTCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_463: (16 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291587902119H30963SW3ICA210SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
343555973959R95229SW3ICA377SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
343560973964R95234SW3ICA396SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4123661122546H98324SW3ICA549SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4351181154125N33725SW3ICA629SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4427351164883N41285SW3ICA1013SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447791167676N43294SW3ICA764SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4448381167735N43337SW3ICA973SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4450461182073N43608SW3ICA1174SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4451201182147N43567SW3ICA980SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4458661182883N44364SW3ICA1202SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7484421662313AA110556SW3ICA1718SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7620961681964AA123669SW3ICA1715SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9246011926203AA283509SW3ICA2631SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9246741927244AA283586SW3ICA2744SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10777432130926AA433449SW3ICA2336SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 9:49:33 on Thu 23 Nov 117.