CBrugiaQ_465


Sequence

>CBrugiaQ_465 (3 EST) Length=1017 GAATGTTTATTGGTGGAGACGGAATGTCACTTATAACCAGTTTCGGAAGGGAGGAAAAAATTTGCATGTGGAACGGAAAT AATTCATTTAGGCCACTAAAAACTGAAAGGCGTGGAGGAGGACGGGAGATAGATGAACTGGGGAAATTTGTAATTCCTGG GGGAAGCTGTAGTTCCCCTTATTTGGATTCTTGGATAGCGTTTCAACGGTTTTTTCTGGAGCTTCAGCGTTTGCCCTGAT TTGGCGTGGTCTAGTGCAATTTCCAATTTCGTTGATATCCGATTCCAATTTTTTCTTCAGCCTCATCAAATCTGCTTTAC TTCTCGTTCAAAGTTTCATCCAGATCAGCTTGAATCGCGAGAAGTTCGGTTTCAAGCTTCTTCTTTACAGAACTCAACGA TTCAGCTTGAGCAGATAACTCATTACACTGGACATGTGCTTCATTCGCATCACGTTCCGATTGTTTACGGGTTCGCNCTG CTTGATCCATTGCAACTGACATTTCCTCTTTCTCCGACTGCAGCAAGGTCGCTTTCTTTTCCATATTCAGATACTGTTCT CGAATCTCTTCCCGATAACGTTGTTCGATTTCAACCTGCTGCTGTAGTTCCCTTATTTGATCTTGATAGCGTTTCACGTT TTTCTGAGCTTCAGCGTTTGCCTGATTTGCGTGGTCTAGTGCAATTTCCAATTCGTTGATATCCGATTCCAATTTTTTCT TCAGCCTCATCAAATCTGCTTTACTTCTCGTTTCATTTTCAAGTGACGCCTGCATAGATTCGATTGCTCTTTGATGATTT TTGCGCGTATTTTCAAATTCCTCTTCTTTTTCTTGGATTCTTTTTTCNAATCTCAGCTCTTAATTGGGGAAACTTCTACC TGCGCCCGAAGTAATTTACTTTCCTCAGCTTCTAGAGCAGCTTCGGCTTTCATCTAGGGCATGTTGTAACTCATCTTTTT CGACTTCCAACCGACGGATTATCTTCTGCATTTCAAATACGGAACGGCCACCTTCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_465: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6837781550537AA057897SWMFCA893SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8639651845413AA224632SWMFCA1093SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8963291890009AA255406SW3ICA2446SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 10:8:26 on Fri 24 Nov 117.