CBrugiaQ_467


Sequence

>CBrugiaQ_467 (2 EST) Length=587 GTAATTAATTGAAGAAGGTTGTTGTAATGACTGTTTACATTTGTCCAGAAACTGGAGATGATGGTAATGATGGTAGCGAG CTGAAACCTTTAAGGACGCTTTATCAGGCAATGATAATTACTAAGTCTTCCAAAGGTGACTTCTTAATAAGGACAAAGAA AGATGGAAAACAAATATGGGAAGCTGCTTCAAAGACGGCATTGAAGAAAAGTTGGAAACATTACGAGCAAGAAATGTTGA AGAATGAAAAAGTTGCTGCAAAGATGTTAGAGAAGGATGCGACAGAAGTGGGAGTAAAAGCAGCCCTTGAAGAAGCCAAA AAAGTGCAAATAGAACTGGACACGAGTCTGTCATATATCACTGGTGTGAAGATTCCGTGATCTAGTTAAGCACCGTAATG AACGTGTTTGCATCAAAGGATGGATTCATAGAAATGCGTCCAACAANGGAAAGTCACCTGATGTTTTTTCATCCCTTCCA AAATGGGACTGGTTTCCCTTCCAAGTTACTACTCCCTGGGATAAATTGTGCCAGACGTATGACGCCCCCTCCCTGGTGAA TACTGAATGCCCCGGTTGAAATATACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_467: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6837911550550AA057910SWMFCA910SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7496751663679AA111789SW3ICA1882SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 17:50:33 on Fri 17 Nov 117.