CBrugiaQ_475


Sequence

>CBrugiaQ_475 (3 EST) Length=590 CCAAGTTTGAGGTAATGCACTTTGTATTGAATCCGTAACAAATCATCTCATTCTTATCAATATGGTTAAAGAAGAAGAAG AAGCTTCTGCATCACAGGCGAGCGTCCTTGCTGTTTTAGCAAGTAATGAGAATGGTTTAAGTAACGAAGATCTGATGAAG CGAACAACGGGAATGGATGTCAAGGCACGTGGCGAAGCAGTCAATGTCTTGTTATCATCGGGTAAAATCGAAATGTTACC TGGTCATACATCTGGTGCATTTATCTTACGTTTAAGGAAGGGCACGCAAATTGCAGATGCTACGCATGAGGAACAGTTGA TTTATTCACTAATTGAAGAGTCGGGTAGAAAAGGTATTTGGATACGAGATATTCGTGATCGGACTGGTTTGTCGCCAACG CCAAATGCGTTAAAGTTCTGAAAGTTATTGGGAACAACGCCAACTTGTCCAGTCCATAAAAAGCGGTAGGTTCNACCAAA AAAATGCTATATGTTATACGAATATGGTGGGCAGAATGAATTCTTTAACAGGTGGAACATTTTATCCCCAACAACAGTTC GGAATCCCAGTTTGTCCAAACCCTGGCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_475: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8675591849789AA228218SWMFCA1256SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855541876958AA246150SWMFCA1631SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12617322392928AA585516SW3D9CA065SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 6:47:14 on Tue 21 Nov 117.