CBrugiaQ_476


Sequence

>CBrugiaQ_476 (3 EST) Length=785 TAATCATATTCGAGGATGCAAAAACACTGGTCACCTCAGCAAGCATCCATATTCCATCAAGGAATGCCGCCAAATTTCCA TACCAACCTTCAAAGACATCGATACAAATGCTGGGAATGGCACCAACTAATGCCGGTGGATGAGTATCTGGTGGTCCAAT CCAGAGCGGAGCAGTGCGCGCACTCTGCGATAACATTTGCATCAACTCACCACGACCTACTAAGTTACTGCGTTGTAACT CATATTTTCTTTTGCGTAACTTTTCGATATCTTCCAAAAGGTTCCTGACGCAAGTAGCTTCTACCTCGCAGGCTTTTTTA GCGTTTTCGTACAGATTTAATACTCGGCTTCGGAGAGCACCACTCAATTTGCATCCAATACTGAGCTTATTCTTATCAAC TAATTCCTGTAGGGTAGACAATGATTCATTAACTATCTTCTTCAGCGGAATTACTGACTTCATCTTTTTCTGGATATCCT GTAGTGCAATTTGCAACTTTTCTTCATCTTTATCCAGCTCACTATTACGTCGTCGCTTACTTCGACGCATTCTTTCACTC AATTGCTTTCTTTTTTAGATCCCTTTCCGGAATAACGAATTATAGCGTCAATGAGACTTCGATATGAAACACCTTTCTGC AGCAATTCCACGCAAACCAATAACTGAGATGGTGTTAGAGGAACACGAAGAAAAANCGGCTAAACTTTCAATCAACTCAG TAGTTTCCTTCGATAACTGAATATTCTCTTTTAAGCCAGATTGCTGGAAACTCATGAGAACCAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_476: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3658071019980H64219RRAMCA017SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6676341537114AA051947SWMFCA832SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11161442199285AA471521MBAFCX3D11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:33:44 on Thu 23 Nov 117.