CBrugiaQ_478


Sequence

>CBrugiaQ_478 (7 EST) Length=587 CGGCACGTTTGAGGTTTTTTTTTGGCGAGCTTGTTGAAAGCATTTAGAAGCAAGCTTAAAAATGGCGGTTGGAAAAAACA AAAAGATGGGTAAAAAAGGCGCGAAGAAGAAGGTTGTTGATCCATTCACACGTAAGGAATGGTATGATATTAAAGCACCA TCAATGTTCAACGTGCAACATATCGGAAAGACGTTGGTGAATCGTACGCAAGGAACAAAAATTGCAAGCGAAGGTTTAAA AGGACGTGTCTACGAAGTGTCACTTGGCGATCTAAACAATGCTGAGTCAGAATCTCGAAAGATGCGTTTGATATGTGAAG ATGTCCAGGGTCGAACTTGCTTAACCAATTTTCACGGCATGCGGCTTACACGTGACAAACTCTGTTCCATTGTCAAGAAA TGGCATACTCTCATTGAAGCTAATGTCCGCAGTCAAGACATCCGATGGTGATTTATTACGGCTTTTCTGCATTGGCTTCA CAAAGAAGAATGCGAAGCAGCTGAAGAAAACAAGTTATGCGAAGTCACTCAAAAATTAAACAAATTCCCTGCTAAAATGG TGGAATACTTGCAGAAGAGTACAGAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_478: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291555902087H30931SW3ICA154SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
299935908739R47561SWAMCA020SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5679041366652W59914SWAMCA964SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6676391537119AA051952SWMFCA840SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8810071870991AA241582MBL2SJ8D7T3Brugia malayi second stage larvae JHU96SL-BmL2
11538462247060AA509183MBAFCX8C05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813952655515AA675809MBAFCW5A11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:22:19 on Fri 17 Nov 117.