CBrugiaQ_48


Sequence

>CBrugiaQ_48 (2 EST) Length=557 CNCCCTCNTTNGAGCTGGCATGGATNGGGGTANNAGCGTGTCCNGTGGGGATTANNATGGATNNGAACTCGAAAGACNAC TAANTGACTCGAATATACCAAAAAAGTATATGAACGACGAAATTCTCGAGTATGATGAGGGACNNGCTATAGAAGAGCTG ATGCCATCCAGTTCGAGATTTCTTGATGATGACATTCATAGTCAGGCACTACTAGAGTTGAATGATGANGCTTTNCTAGA TTTGGTTTCTTCAGATAATGAATCTAATGATTCATATGAAAAACCTCGATACGCACCAGATGAAATACCTGAATCCGAAG ATTTCGCAAATTGGTACAGCAATGAATCGTTCTCACAACCTGTGCAATCGTCGCCAATACTCAAAGAAATTCAATTAAAC ACAAATAAATTCATAACATCTTCAACTTCTTCTGATAAAAGATCATCGATATGTATAGCGCGCTCAGTTTCTGATGGTGT ATGTATGGAGAGAAAGAGAAAGAAGAGAACAAAAGATGAAATAAATGCTGAACGGGCTGCAAAAGAAGAGGCNAGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_48: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4450081172390N43507AS4SLC795T3Brugia malayi L4 JHU93SL-BmL4
12618752393071AA585659SW3D9CA411SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 11:32:5 on Wed 22 Nov 117.