CBrugiaQ_480


Sequence

>CBrugiaQ_480 (2 EST) Length=592 GGNTTCACGATTATCTATAAGATATTTAATATTTGTACTTTAACCCATCAACTGATTCTTAAAAGTGATAACCCAATATA TAAAGCAATCAGAGCGAAAGCCGTAACAACCGTTTCTGATGCAACTGGAGATGATTTCGAAACACCAGGATGTTTTAACT GAACTGTGAAGAGTGATTTCACTTTAGAGGTATCATCATGGTTCCGTTCCGCTTTGCGATATGATGTTAAACCATCTTCA TCGTAAATCACAACATCAAACGTCTGAGCAGCCGATTCTTCATGTTCCAACTGCCAGGATACCTGATGTTTTGACGTTTC TTCAGAAACAGCAGCATGGTATATTTTCCCATTGACGATACCATAAACGGCCATGTCTTTGACATTATTGGAGCACTGCA AATTAAATTCAATAATATAAGTTGTGCTTGAGTGAAAGAAGGCATCGGTGGTTGAGAACGTTGCCGCCGAATGATAGGGT GATTCACACGTGACAGCTTTAGTTCCGACCACGAAGGATACTAATATAACAAATTCCCGAATCATTCCGTGTTTTATTTG ATTACTGTTTTATCGGGTTGCTTCCCTCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_480: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713601855016AA231975SWMFCA1370SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8986091893214AA257646MBAFCZ3D11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 9:24:37 on Sun 19 Nov 117.