CBrugiaQ_49


Sequence

>CBrugiaQ_49 (2 EST) Length=843 TGCATTTCATATATTTGCATCGACTTCTGTAANTTATGTTTCCCTAGTTGAATTTTTCATAATATGCTTATTTATGAACA ATAGAATCACTGTTTAGAACCTTTTTCTGCTTCGTTTATTGATTGTAATTTGGAAGTTTTCATTTTTTTTCAAACTTTTC TATGTTAAAAGAATTTTTTTAGTTTTTTTCGTCATTTAGATGGCAAACTTCGAAAAATTATTGTTGGATGTTGGCCCGAA GGGTCTAGCTCTTATAGCCGGCACTGTGGCTACTGGCCTTGGCATAAAAGAATCACTTTTTTCTGTTGACGCTGGACACA GAGCAATAATGTTCAACCGAGTTGGTGGTATTGGTGACGCTGTCTATAAAGAAGGACTGCACTTCCGAGTACCATGGTTC CAGTATCCAATTATATATGATATTCGTGCTCGTCCCAACCAAATTCGTTCACCAACTGGAAGCAAGGATTTGCAGATGGT GAATATCGGTCTGCGTGTTCTTTCACGTCCCGACCCCGTCCTCATTACCAAAAATATATCGCATGTTGGGGCAGAATTGG GAAGAAAGAATTTTACCTTCAATTTGCAATGAAGTACTCAAAAATGTTGNTAGCGAAATTTAACGCTTCACAGCTGATAA CACAACGGCAGCAAGTTTCTTTAACTTGTTCGTAAGGGTCTGATTGAGAAAACCCTGGAATTCCACATTAATTTTGGATG ANGTTGGCAATTACCGAAATGGGCTTTTCCGCCACANTACTCTGCCAACTGTTNAAACNAAACAATTGCTGCTCAAGAAA CTCAACGTTGCATCTTTTTTGGGTGNAAGAACGAAACCGCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_49: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7620021681870AA123559MBAFCE7H01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12139112334993AA563528SWMFCA2484SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 18:28:16 on Fri 17 Nov 117.