CBrugiaQ_494


Sequence

>CBrugiaQ_494 (7 EST) Length=601 ATATATTTGCCGGGATGAGGAGTATAACTGATTCAGGAAAGTTCTTCATTCTTCCGTTCCCTTTAAGAGGCTGGACCAAT TGTAAAATTCCTGGCAACGCGGAAACCAAACCGTTCATTTGGCTTCCCGCTGCTTTCTTCGTTTTCGCATAGATCAAGGT AAAAGCATAATCGTTGTTGTGCCTTGATGATTTCCTATAGTAAGTGAAGGCAGGGCGAGTGGAACTCCTTCATCCTCATC TTCTCCGCCGTCCATATCTACTGAATGGTTGACATTAAAGTATACATTAATTTTTTCACTGCCGTGCAACTTTGCCAAAT GTACATTGGCACCATCAGTTGTAATTTCGAAACCCGAGATTCTTGGAGCTTGTTCACCACGAAGATTTTCTTTCTCCAGT TGTTTCTCAGCGGTAATTTCATTCTTTAGCGCATCAATTAATTCATTACTTAATGGTCGGGTGGTCGACATCTGTCGAGC CATCAAAACTGGTTGTGACATTCTTATTCCAGAACAAACAGCTGCTGTTGAAACATGCCTCTGCAGAGCTTTTGACAATG CGCGACATACTGCAGTTGACCGCATCTTGACTACCTCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_494: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350156988787H48946SWMFCA056SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
3950951088232H92654SW3ICA512SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4448011167698N43316SW3ICA896SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4809821236219N74820RRAMCA1091SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5014311266952N94671SWAMCA467SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6826141549442AA056802SWMFCA1011SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10988352168005AA454336MBAFCX0D04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:5:59 on Sat 18 Nov 117.