CBrugiaQ_506


Sequence

>CBrugiaQ_506 (7 EST) Length=555 GAACTAATTTCAGTTTTATTCAACAACAAACATTATCGAATTTTATGGAATCAATTTTCGCTCATAAACGGATAAAATTA TACGACTTGAACGCCGATAATTCTACCAGCATTTTGTCCCGTAGTCGTCCGATTAAGTCTAAGTACAAGTGGTCTGCCAG TGTTCCAAGGTAGCACTGCATCAGTTATGTGACCATCTCGCATTAATTGTGTGAGGATATTCATGGCAAGAGGGGAAGTG GTATGCTGAGATGTGCTTAGAAAGATAAAAGTGGTATAGTTGAAAGTAATATCAGTGAAGAAAAGATTGTCAAAATCGTT GTCATCAATATCGTCAGGCTCACCGTATGAGTAATAATCCTCAATTTTGTCGTTATCAACCGGAGCGGATCGCTGCGACG CTACTAATAATATGCTTGTGCCGAAAATGCAAAAAAATAATGTAAAAAGTGCAAATCGTGGGTTTCTCATAATTGTAGAG CGTTTCCAGAATTAGTGCCAATCGTTTTTTGAAAGTAAAAATGAAGACCGGATGAATTTGAGGGACAAAATGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_506: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4425621164710N41112SWMFCA284SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8854901876894AA246086SWMFCA1227SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855191876923AA246115SWMFCA1577SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10988262167996AA454327MBAFCX0C07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12354532369548AA584995SWMFCA2816SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12355082369603AA585050SWMFCA2907SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12774292429571AA598378SWMFCA2941SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 6:15:16 on Thu 23 Nov 117.