CBrugiaQ_51


Sequence

>CBrugiaQ_51 (3 EST) Length=857 TATACAATGGGATATCCAGCTCATGTACCGAGAGGAGGCGCCAGTACCAATGGAGTTGGCTTTCGAGGTTCCCCGAGAGG TGGTGGTGGTTTTCGAGGGTTATCAAGAGGTGGTGGATTTCGTGGGTCACCCCGAGGAGGAAGTGGTCGAAGTGGTTTTG GTGACAAAAACAGTGTTGGAATGGGAAGTTTTGGTGACAGGAGAAGTGGTGGCGGTGGTGGAAGAAGCTTTCGTGGTATG AATGGAGCAGATGTTCGCGGAGGTGGAAGAAGACGATCACCGCGTGGTCGTGCAAGTCCTCGAGGTGGAGGACGAAGTGG AGGAATGCGGGGTGGCAGAAAGGTTATCATCGAGCCACACCGACATGAAGGTGTTTTTATCATCAAAGGCAAAGAAGATG CATTGGGTACTCGGAACTTAGTTACTGGTGAATCAGTGTACGGTGAAAAAAGAGTGTCCATTGAAAATGATGATAAGGAA AAGGTTGAATATCGGGTTTGGAATCCTTTCCGATCAAAATTGGCAGCTTCCATACTTGGTGGTTTGGATGATATACATAT CAAACCGGGATCAAANCTNCTGTATTTGGGTGCTGCATCGGGCACTACTGTTTCTCNCTGCTCTGATATCGTTGGTCCAA ATGGTTTGGTTTATGCCGTGGAATTTCCCCATAAATCTGGTCGAAAACCGTTGAATATACCAAAAAAGAGACCAAATATC ATTCCCATTGTTAGACAATGCTCCTCATCCTCAAAAATACAGGATGCTTGTCGGAATGGTGGATACAATATTTTCTGATT TCCCCCCGATCANCCAAATTNTGCTTTAATGCCCCCTTCCTGAAAATGNGGCCNTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_51: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713421854998AA231957SWMFCA1351SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11161262199267AA471503MBAFCX3C04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12213192345216AA570923SWMFCA2753SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 7:0:32 on Mon 20 Nov 117.