CBrugiaQ_515


Sequence

>CBrugiaQ_515 (24 EST) Length=595 AAATTACGGTCAATAAATTTTTATCAACTGTAGTAACAACCGATTATATAGGATAACACTGAATTACACATAAACTGTAA AAAATATAAATTTGGACATTTCACAAANGACGACCACGGACGACCACCCTTACGTCTGGTACAATCCGTTGGGATAGGTG TTACATCTTCAATCCGCCCAATTTTAATACCAGAACGAGCCAATGCACGAAGTGCGGATTGGGCTCCTGGTCCTGGAGTT TTTGTTTTTGTTCCACCTGTTGCACGCAACTTGATATGTAAAGCGTTAATTGATAGTGCTTTACAACGCTCAGCAACATC CTGTGCAGCCAGCATAGCAGCATAAGGTGATGCTTCATCACGATCTGCTTTTACCTTCATACCACCAGTTACACGCACAA TTGTTTCTCGGCCAGATAAATCAGTGACATGAACGAAGGTATCATTGAAGGATGCAAAAATATGCGCCACACCAAATATA TTTTCGCCTTCCTTAGCCTGCGGTCCTAATGTAACCACTGGTTGATCCTCCTTAACTTTACCCTTCCGCGGTGGCATCTT GAGTTTCCTATGCTCAAACTTGGGTAATAAACCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_515: (24 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435249
217582808404R47517SW3ICA010SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
281858890042H21347AS3ISB361SLBrugia malayi infective L3 JHU93SL-BmL3
3644791017406H63060AS3ISB128T3Brugia malayi infective L3 JHU93SL-BmL3
4157201122663H98442KJ4SLB139T3JHU93SL-BmL4 (JHU)
4452091182236N43708SW3ICA741SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5594151345236W51523AS4SLC540T3Brugia malayi L4 JHU93SL-BmL4
5595141345335W51534AS4SLC903T3Brugia malayi L4 JHU93SL-BmL4
5595321345353W51506AS4SLC934T3Brugia malayi L4 JHU93SL-BmL4
7473501660960AA109464MBAFCE2F10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8640561845504AA224720SW3ICA2166SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8810251871009AA241704MBL2SJ8F2T3Brugia malayi second stage larvae JHU96SL-BmL2
8963231890003AA255400SW3ICA2440SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8982401892845AA257369MB4SLM2A9T3Brugia malayi L4 JHU93SL-BmL4
8986581893263AA257773MBL2SJ3A6T3Brugia malayi second stage larvae JHU96SL-BmL2
8986691893274AA257784MBL2SJ3B7T3Brugia malayi second stage larvae JHU96SL-BmL2
8987171893322AA257741MBL2SJ3G6T3Brugia malayi second stage larvae JHU96SL-BmL2
9164181917038AA275403MB4SLY1B04T3Brugia malayi L4 JHU93SL-BmL4
9164191917039AA275404MB4SLY1B05T3Brugia malayi L4 JHU93SL-BmL4
9165211917141AA275493MBL2SK1D09T3Brugia malayi second stage larvae JHU96SL-BmL2
10482252064872AA406802MBAFCZ6D04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10777422130925AA433448SW3ICA2334SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10989102168080AA454411MBAFCX1C07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12652252402596AA588933KJ4SLB442T3JHU93SL-BmL4 (JHU)


Date: 12:43:47 on Sun 19 Nov 117.