CBrugiaQ_521


Sequence

>CBrugiaQ_521 (6 EST) Length=322 TGGGGNCCCGGCCCCCCCCNGGGGTTTTTTTTNTTCATTTTGTTGGTAGCATATCTAGCTTAAAATGCTTATTAAGTCTA CTTAATTAAATGATAAAATTAATTAAGCTATCGCTTTATCTTCATTGTTATCGACGGTTAGGCGATAACTTGGATAAAGT ATAGACACCAACGAATATCACCGTTTATTCATATTATTATTATTTATGCTACTACCATATTAAAATTTATTAACATCAAT CTTATTAATAACACATACAACAATATGTTGTTAATATAGTATCATAATATATATATATATATATGGTAGGTATAATAATA TA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_521: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5477011322255W39853RRAMCA140SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6364151486180AA022398SWMFCA536SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11938672315019AA547818MB3D6V1D01T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
11939352315087AA547886MB3D6V2D01T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
12354122369507AA584954SWMFCA2675SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13667792605317AA661273MB3D6V4H12T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 19:56:28 on Sat 18 Nov 117.