CBrugiaQ_530


Sequence

>CBrugiaQ_530 (4 EST) Length=589 GGAATTCGGCACGAGCAAGTTTGAGAATTTAAATGAAACCTGAAATGTTCTCGATAACTAACTTATCAATCATTTCTCTA CTTATTACAATTCAACTTCTGCCCATCTTCCATCATATTTATGTCTTAGGAGATGGTGAAGTAACTACGGTAACAGCACA TGATGGACTAACTACAGAAACTCAACCGGATGGGTTAAAGCAGGACTCACTGGATGGACTACGACAGGAACTCAACCGGA TGGACTAACGGCAGTAACTGAACAGGGTGCAGGAACTGATGAATCTATGCGTTTACTGCCTCTCATTCAAGAACATTCAC CATCGGAAAAAGATTGTGATGCAGCAATAACTGATCCGGCAGTAGCAACCGAATTAACTTCAAAACCATACACTGTTGAT TCTGATAAAGCAGATGCAAATATTAGCAATTCATGTGAGGATATCAACACGTGGATTATTCCGGAAAATCCTGCAAGTGA TGACGAGAAAGATTTCCAATTGGTTTCATCCGAGTTGTTTACAGGGGCTATCACATCCAGGAATTGCTATTTAATTGGTG GTTTGCTCCACAGGATTATTGGTATGCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_530: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
296622905426H35927SWAMCA201SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5596391349145W51716SWAMCA611SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6001011420939W91855RRAMCA147SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8679711850736AA228630RRAMCA397SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 2:48:56 on Thu 23 Nov 117.