CBrugiaQ_532


Sequence

>CBrugiaQ_532 (6 EST) Length=573 GGTCCATTGNGGCAGTAAAGTTCAAATAANTTTCATGGTGGCCAGAACGTGTTCGTTCACGGATCAANTTTNGGGAATTT TTCTTTNGGTAAANGTTTCAAATTTGTTCAGGCATAATCAAGAACAGGCATCTGGATGTTTCNNAACGTAAAATATTCAT GGCATCTTCATTTTCTAATTGTGACTCTTCCAAAAGTTAACGTAACTTTTGCAATTCCGCTTCACGTTTACGATTTGATT CGATCTGGCTATCAGTGGTACCTTCCGCATCTTCAAGTCTATCCGTTAATGCTATTAGTTGTACGCTAAGGTCAGCCCTT TCTCGTTCGATTCTATTTCGAAGTTCACGTTCGGATTCGAGATCTTCTTGCAGTAGACGAATCTTGTCCTCCAAGCGAGT TAAACTTCCCAAATCGGCAACCGACATACTACCGAATGCTGCCGGTAAACCACCAAAAGCACTCATTGATGGACTTTTGT AAAGCGCAGCTGAAGGACTTCGATACAGTGAACCGGACATCGTTTCCGTTTCTTCTTTTCTATTTCGTCTCACTTATTAA TTTTCCCTCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_532: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4448151167712N43192SW3ICA911SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4450951182122N43542SW3ICA827SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6001041420942W91858RRAMCA155SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7061921592610AA072484SW3ICA1628SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8428471799512AA203769SW3ICA2047SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10482292064876AA406806MBAFCZ6D10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 18:17:10 on Fri 17 Nov 117.