CBrugiaQ_533


Sequence

>CBrugiaQ_533 (3 EST) Length=588 CTCCTTCCACCAATAGGATAAACCGTTGGACGGTAAGATTTAATGCATTTATTTGACCTTTAGCAGCAGCTTTTTCGAAC ACACATTTCTGAGCGCATTTTGGACTGTCCATAAATTCCCAAGCATAAAATTATTGGGAAAATTCAAATGCATCTGTTCC GATAACCCATAATTGTCACCCCACTGGCAGGCATGCATATGCATCACTTATATGAATCAAATGTGGAATTTTCTCTTCAT GCATAACTTTTAATAGAATTTCCGTTGCATTTGTATTATCATGCCAGTATTGATCAGTGTGATTTATACCGTCATGTAAA TATTCCAGTGATTTACCAGCGCAATGAAAAACGGTTGTTACAGAGTTAAGCGCTAATTTAAGCTTTTTTTCATCACAAAT ATCAAATTGATAATGATTTAAAGGAATGCGTGATGGATAATCAAGAAATTTGCTGAATGAATTTCTATCAATAGTTCGAA TCTCGACAACAGTACTTTCGAGATGATTGTCTCGCTGTAAACAGAAGATGAGATGCTGCGCAAGAAATCCACTACCACCT GTTATGGCAACAACTTCCTCAATCGTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_533: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291606902138H30982SW3ICA232SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4811861237156N74847SW3ICA1414SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
12212972345194AA570901SWMFCA2713SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:41:38 on Sun 19 Nov 117.