CBrugiaQ_541


Sequence

>CBrugiaQ_541 (7 EST) Length=563 NAAATCGCAGGTGATCAGCATAANATATCTCCNATGGATGCATTNTANCCAATAATGACATGGTAGGTATGAATACTTTT CTAATATTAGGGGGCTAATTTTTTGCAATTTTCGAAAAACCATTTTCTTAACAAATCTAAGTAATTAATCTTCACAACAG TAGCGAAAACTTAAAATGCGAACAAAATACAGAAACCCATACAAAGGCAAAAAAGGCCCATAGCCTCAGAAAGAGCAAAG CCAAGGATTGCGTACGAAAAGAGCTGGTTTTTCGCGGATGGATTTCGAGCGTAACCGATAACAAGAGAACCGAAAACGTT GCCGATACCAGCACCAGAACCTGCTACACCAACTGTTGCAGCACCAGCTCCAACATACTTTGCTGCACTATCAATGTCGC GATGCACTGAAGACGTTTGCAAACTACGAACTAATACTCCGTTATTTGAACGAAGCAAAACTGGCAGCATCGAAATACGA ACTGCAGAGGTCGAAAGTCGTTGGCAGTACATACTGAAGAATTTTACCAAATTTCTTGGAATTCAACCGAAGCAAAAGAA CCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_541: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4426741164822N41224SW3ICA1059SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4459501182967N44448SW3ICA1308SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7619601681828AA123657MBAFCE7C04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9165081917128AA275480MBL2SK1B07T3Brugia malayi second stage larvae JHU96SL-BmL2
9246041926206AA283512SW3ICA2636SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
13666892605227AA661183MB3D6V3G11T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13813332655453AA675747MBAFCW4C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:13:8 on Sun 19 Nov 117.