CBrugiaQ_542


Sequence

>CBrugiaQ_542 (4 EST) Length=769 AGAACTTCACGTTGTCCCAAATAAATCATTTTTAGGTGCTACTGGATTTTTTATGTATGACCATCGACCTTTTTGAAATA CTCCTTGGACTCCTTGATGCCGGGCTTAATTGTTGGCTTATCATCGGACCAGTTTGCCGGACATACTTCACCATGTTTCT CCACAAACTGAAAGGCTTTTAGCGTACGAAATGCTTCATCCACANTACGACCAACCGAAAGATCAGTCACGAGTAGAAGG ACGGAGCGTTCACCACTTGGATCGATTAAGAACAAACCTCTATATGAGATACCTGTTTCATGATCAAGGACACCGAATGC ATTCGCTATATCTTTATTAAAGTCTGCAAGCACTGGAATCTTCATGTCACCGAGACCACCTTCACTAACGTGGGGTTTGG AATCCATGGCTAGATGTGAGAAATGTGAATCGCACGGAACATGCAATCAGTTCTGTGTTTAATTTCTGAAACTCCGCACA TCGATCGCTAAAGGCAGTAATTTCGGTTGGACAAACGAAGGTAAAGTCAAGAGGATAAAAAAACAGGATAAGCCATTTTC CTTTGTAATCTTTCATGCTAATTGTTTTAAAATCTCCATTTACAACTGCTGTGCCAGAAAAATCAGGTGCTTTGTTTTTT GGACCCAAAGGTCGAATGCCAGCTAACGTAATAGAGGACGTGCAAAGTTGACTTGCAAGTATCTGACGAAGTGGCGACAC TGAAGCTAACACTGAACGAATCATTTTGCTCCAATTTACTTGCTATCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_542: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217660808482R47595AS3ISA009SLBrugia malayi infective L3 JHU93SL-BmL3
7272531634898AA089419SW3ICA1789SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8248991769728AA185840SW3ICA1937SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
12618302393026AA585614SW3D9CA328SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 6:16:40 on Sun 19 Nov 117.