CBrugiaQ_545


Sequence

>CBrugiaQ_545 (2 EST) Length=565 AAACAATCTACAATTTCAACACTTTGTTTTGGTCGATCACCTGGATGTGTTGATGTTTGCTCAATTTTTCTAACAACATC CATACCACTTAGAACTTTTCCGAATACAACATGACGACCATCTAGCCATGTTGTTTGCACCGTTGTTATGAAGAATTGTG ATCCGTTGGTATCTTTTCCTGCATTAGCCATACTCAACCAACCAGCACCATAATGCTTCAATTNGAAATTTTCATCCTCA AAACGATCACCATAAATACTTATACCTCCAGTTCCATCTCCTCTCGTAAAATCACCACCCTGTATCATAAAATCTTTGAT TACACGATGAAATTTAGATCCTTTGTAGCCAAAACCCTTCTCACCAGTAGCCAATGCTCGAAAGTTTTCTACTGTTTTCG GCACATCATTACCAAACAGACCTATTTCTATTCTTCCGATCTTCTTATCACCGATTGCAATATCGAAATAAACTTTCTTA GTAACTGTTGCCATTTCCTTAGCATTATTAGAGGTGTAAAAAGTGACAAATATAGTAACTGTCGTCAGAATGAAGTTCAT AATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_545: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826041549432AA056772SWAMCA1539SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8987521893357AA257841MBL2SJ4B7T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 20:45:59 on Tue 21 Nov 117.