CBrugiaQ_547


Sequence

>CBrugiaQ_547 (4 EST) Length=965 GAGGGAAAGAATGAGCACCAAATCAATGATTGGTATTGCAACGGCCAGTTGCGCCTGTATCATTGTCATATCAATGGTCG CTGTTTGTGTAATATTTAATGAAATAAACAATTTGCATGACGATGTTATGGATGAAATGGGCGTCTTTAGAACAGTTGCA GATGATACTTGGGAAAGAATAGTAATGCTTCACTTTGGTCCAGGTGGTCGTCGACAAGAAACATTCTCCTCTTTGATTAA CCGATACAAACGACAATTCATTCCACCACCACATTGTCAATGTCAAGCGCCAGAATTATGTCCACCGGGACCACCAGGAC CACCAGGTGATAAAGGTCTAAGAGGTATTGATGGACCGATTGGCAACGATGGTAGAGACGGTGCCAGTGGTGTATCACTG TTAGCGACATATCACTTTCCTGGTGGTTGCATAAAATGTCCTCCGGGACGACAGGGACCACCTGGACCTAATGGTTTAGA AGGAGATTATGGAGCCACAGGACGTCGTGGATCACTTGGAATACCGGGTAAAAGTGGACAACGTGGACCAGTTGGACCAC CAGGTGAAATGGGTGAACCAGGACCTGATGGAACACCTGGAAGGCCAGGATCACCAGGAAGAGATGGAAAGCGAGGCATT GGACCACAAGGACCGAAAGGACCAACTGGACCAAGAGGACCACCAGGTTTGCCAGGTCCGGATGGAAACAGAGGTGCCGA TGGTGAACCAGGAGAACAGGGAATGGAAGGACGACGAGGAAATGATGGTAGAAAAGGCAATGATGGACGTCCTGGAGCGC TTGGTAGGCCTGGTCTACCAGGACCAGATGCTCATTACTGCCCATGTCCACCACGAAGTTCAGCTTACCTAACGAAGATA CATTGACGATAATCGACTCTCTCTCTCTTTATATATACATATATGCTCATTCAAACGGTGACATGGANATATTAAATTTC TTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_547: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826081549436AA056776SWAMCA1544SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7472661660876AA109406MBAFCE1F04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7497101663800AA111824MBAFCE2H05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161272199268AA471504MBAFCX3C05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 13:43:25 on Fri 24 Nov 117.