CBrugiaQ_550


Sequence

>CBrugiaQ_550 (2 EST) Length=585 AATGAACAACGTAATAAATCGCATCAAATCTGGCTTCAATTCAGCTGAATATGGCTTGCCTGCTGATTTTTTACTAACAA AGCTAACACAAATGAAGGGTTGTGGATGTAAGGTTCCGAGAGCGGTTTTGTTGGAATTTTTGAAAGACTTGAAAACGGAT GGCAAAAGCGATGAGAGAGGTATCGGATTTGATAGCTGTGTGATTCCTTTGCGACACCGAGGCTTGTTTCTCGTACAGAC AACAGACTTTTTCTACCCTCTTGTTGATGATCCGTATCTTATGGGCAGGAATCACTTGTGCAAATGTTTTGAGCGATTTG TATGCCATGGGAAGTGGTTGAACTGTTGACAATATGTTTGAATTTTACTTGGCATACCCCAAGGGATATCCAGTTGAACA AAGAACGGGATGTTTGTCCCCTACCAATTTCCTTCCGAAGGGTTTCCAAGGATACTGCCACCAAAACCTTGTACTGCCCA TTAGAGGTTGGCCAAACAGTGCGTTTGTCCCTTGGTTGCCGGCTTGGGTGGAATTAACCACAATGTGTGCAGTGCTAATG AAATGGGCTACGGTTGACGGAACAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_550: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6838071550566AA057958SWMFCA933SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12618372393033AA585621SW3D9CA337SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 6:1:23 on Wed 22 Nov 117.