CBrugiaQ_554


Sequence

>CBrugiaQ_554 (10 EST) Length=574 NAAAAAACCGGGGGANTTTNTAACCTGGAACGTTGNGGAATTTTTGTGGGACGCTGAATTTGGCAATTCTTTCAATTTGG ATTAATAACTAAAATTGGAAAACACCAATTGCTTTTGTTCAAACCTTTTTGGAATAACGCTTTCCATACCAGTCCACAAC TTTTCCAATGAATCTGAGGTATCCGGTTTCTTCATTTCATGATCAAAAGAAGTTGGCATATGAATGAGATACAAATCTGC ATAATTTGTTCGTAATTTCTCCAACGATTGACATAATTGTCCTTCTACTTCTTTTGCACGATTATGTGTACACCATAACT TTGTAGTAATGAATACATCTTCTCTCTTTAGTTTACCAGGTTTGATATATTCTTCATCTAAAACCTTACCCAAATCTTGC TCATTAAAATAACAAGCAGCTGTATCAATTAGTCGATAACCATTGTTTAATGCATATCGAACTGATTCAGATGCTTCACC GGGTTTGGACAACCACATTCCTAAACCAATGATTGGCATTTTTATACCGCTCGAAAGACGAATTGCTGGCACCGCCATTT TTAGTAATTTATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_554: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217610808432R47545SW3ICA112SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4446961167593N43211SW3ICA1133SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4448281167725N43327SW3ICA925SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4459091182926N44407SW3ICA1277SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4809561235925N74794SW3ICA1404SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4811791237149N74840SW3ICA1374SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7272191634864AA089385SW3ICA1591SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7272611634906AA089427SW3ICA1798SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7496581663662AA111772SW3ICA1857SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
13666532605191AA661147MB3D6V3C11T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 17:45:23 on Mon 20 Nov 117.