CBrugiaQ_561


Sequence

>CBrugiaQ_561 (3 EST) Length=1049 GGATCCCCCGGGCTGCAGGAATTCCGCACGAGAAAATTTTCAATGCATTATGGAAAACAAAATATCTCACACAATTTATA AACATATTGAAAATAATCCACCAGTTGATCGTCGTATTTTGTCAATTCAAAGTCATGTGATACATGGATATGCTGGCAAT AAATGTAGTGTATATCCAATGCAGCTACATGGTTATGAAGTGGATCCGATTAATTCGGTACAATTCTCTAATCATTCAGC ATACAAATTGATGCGAGGTCAAATATTGGATGGTTTGCAATTAAGTGATATTTATGAAGGTGTGAAACTGAATGAAATTA ACAACTATTCACACATTTTAACAGGATATTGTAGGAATTTATCATTTCTGCAAGAAGTTGTTAATATANTCAAAGATTTG AAGCAGAGAAATCCAGATATTCTTTTCTACTGTGATCCTGTAATGGGCGATGACGGCAATTATTATGTTCCGAAAGAGTT GATGCCAGTTTATCGTGATATTGTAATTCCTCTGGCTGATGTAATCACACCAAATGTTTTTGAATTATCTGAACTATCTG GTTTATCAATAAATAATGAACAAGAATGTTTGGAAGCAATTGATTTAATGCATAAATGTGGTGTTAAAATAGTGGTTGTT TCAAGTGGTCTGGAAACATCAACTACAAAATTTTGTTATGCATCTGTTTACAAAGGCGCAAATGAACGAGCATTGCAGTA TCGTTTTGATATACCAATATTACCAGGAAAATTCGTAGGTACTGGTGATGTTTTCATCAGTTTACTCCTTGTTTGGATGG ATAAATTGGATGGTGATATTGCATTAGCTATTCAAAATGTCATTGGTACTTTACAGGGTATATTAAGACGAACTGCAAAT AAAGCTTATTATCAGCGAAATCCGAAAGAATATAGTCCAACATCGAAGGAATTGGAATTACAATTGGTGCAAAGTCGTTT AGATATACTTGCTCCACAAGTTACTATTAAATCAACAAAACTTTATTAGTATTAATTTCATAGTTTATTGAAATCTTCTA CAATTTAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_561: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8196611763842AA180650MBAFCG1E12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11535662246780AA509331MBAFCW1A07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13668872605425AA661381MBAFCW3D02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 3:43:10 on Sat 18 Nov 117.