CBrugiaQ_57


Sequence

>CBrugiaQ_57 (5 EST) Length=862 CCCCGTAGATTTTCGGAGGAACTGGTCCGGTTTCGATTCGGGTAACTGGGTAACGGATTTCGTGGTAAAATTCTGGAAGC ATGGGTTCTTCGTAAACATTTNTGCGGCTTATCCTGTAAATGATANTTGCATACTTGGATCCAAAGACGNGCACATNCCA AGTTTCTTTATCTTTGCCATCGGAAAAGGAAAACGTTAGCCAGTATTCGTTCGATTGCAATGGTCCAAAGAAATTTTTAG GTAATCTTCAGTGGTGAACACTTTGTTAAATGTCATCGTCCAATGTCCTTTCGGCGGAGGACACAACTTATTTTGTCGGA TGAATTCGTGCGCCTTCCGATCAGTTATATATTTATCCGCTGCTTTCACCGTTTCATGACATTTGTCCAGCATATCGCAA TAGCGACAAGAACCGACTCCATCGCAACCGTCGATGAAATTCCAACCTTGGCATGGAATTACCTGCCAGCCCTTTGATCC TTGTTTATTCGTTACTGCATGCCTTACCTCGACATCCATCTCGATCTTATCCTGCGGTAATTCTTCGCTTACATCCATTG TAACATTGAAAAATATAGGTCCCGGGAAACGTGGATAGTCTGGCCATACGACAATATTTGAAACATTCACTACATAGTTT GTCCACTGTTCACTTGCACATCGACTGAATTGCCACCCACGAATGACAACACCATGCGGTCCCGTGGTGTATTTTTCCCA GAATGGCACATGCCCAGGGAAAGTTTCTTCCCAAGCACGCGATAATGCTGATTGGGCTAATGTTTTAACATACAGCATTG CCAATATGAAATGCGTGAGGGTACACCTCAACATCTGTAAAATCTCAAACTTGCTCGTGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_57: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6462431502073AA032101SWAMCA1093SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
9246831927253AA283595SWMFCA2164SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10751192113596AA430774RRAMCA1520SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11253462209414AA480716SWMFCA2071SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12774162429558AA598365SWMFCA2926SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 22:58:37 on Wed 22 Nov 117.