CBrugiaQ_570


Sequence

>CBrugiaQ_570 (8 EST) Length=565 ACAAATTTTAAAACCCAGGGACAGAATGNGAACCATGATGAAAAATTTNGGTATGGTGGGGCTGACAACAACCTGGTGGT CGGCCCATTTGGTTCCACGGAAAGACAATTGGGAACATTTAATTCGACCAGCTGAACATATAATAAGTTTTAGCTGGCGC TATTAATAATGTGATCAATAACACTGCATTGAAAAATTAAATGTCATCATTTCACATATTGGACGTAGTCCTAGAAATGC TGCTCCAACAGCCATTCCAGCAAAACCCATTTCAGAAATTGGTGTATCGAAGCAACGTTTCTCACCATACTTTTTCATGA TACCTTTTGAACACTTGTAAGCACCTTCATAATGTGCTACTTCTTCACCTAATAAGAATACTCGTTCATCTGCTGCCATT TCTTCATCTAATGCTTGTCGTATTGCTTCTCGAACTTGAATACCATTTGTTACAGCAGGTGCTGTCACCAGAAATCGTTT TGATTGTGTTGGTAATGTTCGAAATATTAATTGACCAAAATGACTTACGTTGAATACCATCACGTTCACGTAGATTACTG CTCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_570: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4448211167718N43198SW3ICA917SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4450571182084N43619SW3ICA773SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7092471613921AA074017SW3ICA1674SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7272521634897AA089418SW3ICA1788SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7272591634904AA089425SW3ICA1795SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8865141878426AA247097SW3ICA2199SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10777222130905AA433428SW3ICA2663SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10777232130906AA433429SW3ICA2664SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 21:38:4 on Fri 24 Nov 117.