CBrugiaQ_571


Sequence

>CBrugiaQ_571 (2 EST) Length=558 CAAGTTTGAGGCCCACAAATTGACGTTGGCTGAAGTCAATAAAAGCAGCCAGCAATGACCATATTTGGTCATGGGTCAAC CTCCAAAAAGGATAATACAATTGATAATGGCAATTCAAAGCCTACAGCACTACTCGACGGGGTGACAACACCAGCACCAG GTTTTGGAATTCGTACATACCTTCATCAATTTTATCAATCACCAGCTGTTGAGGACATCGAATCTGCTGGAGCCTGGTAT CTTTTACCACCGCCACCAGCACAACGAACAGGACTTTGGCTCTGTCGTATGCTAACCGTTCTTGGCTTAATTCTATAAAT TGGTGGAGCAGTTGCTATTATTGTTGGATACACTTGGCCTCATGAAGGAGTTGAAGAATCGATTGCTCGAATTGCTATCT ATCAAGATGAAGATGGAAACTTTTATGTTCCACCGCGATAAAACTTGCCGAAATATTAAAAGATCCTATGCGTCCTTGGG AAGATGTTTGCGTTTATGTTCGTTTGCTACCGAGTGCTGTAATGCCTGGCATTAAGTTATGCTAACACCAACATTGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_571: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10482782064925AA406933MBAFCZ7A04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11587792252956AA514139SWMFCA2244SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 15:5:10 on Thu 23 Nov 117.