CBrugiaQ_577


Sequence

>CBrugiaQ_577 (3 EST) Length=556 GGCAAAAGGAAAGTAAAAACCTGTACCCAGAGAAAGGCCAGCAAGGTCGGAAATTCAGAGTTCATTACACACTGCAAGTA GGATCCTAAGCATAATTTACAAGTGTTCAGAGAAGTGGGTTGTCTATGTTACCAGATGGTTGAATATCATGGTCACTACC TTGAGTGAAATGAGTGTTTACGAAACGCTGTCCACAATAACCACATGCATGAGTGCCAGGTTTATCCAATTTAATATATA CACGTGGATGACCTAATGCTGAATGACCACCATCACAATGTACGATACGTTGATCCGTTTCAATTGGTGGTACTTCAGCG ATCAACTTTTGTGCAACATTTGGATTTACTTGTTTCGGCATTATAGTAAACCTTACATTTCGATGATCGGCTTGGTCCCA TACCTGCCCAGTATGTGTAACCTTATCATACACAGCATTTAATGGCGTGACATCTTTTGGTGCTAAAACGTCTGATTTAG CACCAAACGCTTGTGCAAACAGACGTGATAATCTTCGGCTAANTANTGTCATCTAAACAATAGCACCTCAAACTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_577: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217676808498R47611AS3ISA057SLBrugia malayi infective L3 JHU93SL-BmL3
276422881988H16484AS3ISB276SLBrugia malayi infective L3 JHU93SL-BmL3
11919372307179AA545888SWMFCA2438SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 22:53:11 on Wed 22 Nov 117.